193 lines
20 KiB
XML
193 lines
20 KiB
XML
|
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.421.6342" ID-GBIF-Dataset="1e1b1e6b-a12f-4985-a041-cfc4ca1c7511" ID-PMC="PMC4109470" ID-Pensoft-Pub="1313-2970-421-39" ID-PubMed="25061379" ID-ZBK="748B04579F8443E5A165C2CE1A36CE58" ModsDocAuthor="" ModsDocDate="2014" ModsDocID="1313-2970-421-39" ModsDocOrigin="ZooKeys 421" ModsDocTitle="Four new species of Symmerista Hübner, 1816 (Notodontidae, Nystaleinae) from Costa Rica" checkinTime="1451245680270" checkinUser="pensoft" docAuthor="Chacon, Isidro A., Janzen, Daniel H. & Hallwachs, Winnie" docDate="2014" docId="C315E16D7E9C1FCCB655B913238C1DBC" docLanguage="en" docName="ZooKeys 421: 39-63" docOrigin="ZooKeys 421" docSource="http://dx.doi.org/10.3897/zookeys.421.6342" docTitle="Elymiotis tlotzin Schaus 1892, comb. n." docType="treatment" docVersion="3" lastPageNumber="59" masterDocId="8254FF93733E5A70FFF5FFF73375FFBF" masterDocTitle="Four new species of Symmerista Huebner, 1816 (Notodontidae, Nystaleinae) from Costa Rica" masterLastPageNumber="63" masterPageNumber="39" pageNumber="54" updateTime="1668158804465" updateUser="ExternalLinkService">
|
||
|
|
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||
|
|
<mods:titleInfo>
|
||
|
|
<mods:title>Four new species of Symmerista Huebner, 1816 (Notodontidae, Nystaleinae) from Costa Rica</mods:title>
|
||
|
|
</mods:titleInfo>
|
||
|
|
<mods:name type="personal">
|
||
|
|
<mods:role>
|
||
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
||
|
|
</mods:role>
|
||
|
|
<mods:namePart>Chacon, Isidro A.</mods:namePart>
|
||
|
|
</mods:name>
|
||
|
|
<mods:name type="personal">
|
||
|
|
<mods:role>
|
||
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
||
|
|
</mods:role>
|
||
|
|
<mods:namePart>Janzen, Daniel H.</mods:namePart>
|
||
|
|
</mods:name>
|
||
|
|
<mods:name type="personal">
|
||
|
|
<mods:role>
|
||
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
||
|
|
</mods:role>
|
||
|
|
<mods:namePart>Hallwachs, Winnie</mods:namePart>
|
||
|
|
</mods:name>
|
||
|
|
<mods:typeOfResource>text</mods:typeOfResource>
|
||
|
|
<mods:relatedItem type="host">
|
||
|
|
<mods:titleInfo>
|
||
|
|
<mods:title>ZooKeys</mods:title>
|
||
|
|
</mods:titleInfo>
|
||
|
|
<mods:part>
|
||
|
|
<mods:date>2014</mods:date>
|
||
|
|
<mods:detail type="volume">
|
||
|
|
<mods:number>421</mods:number>
|
||
|
|
</mods:detail>
|
||
|
|
<mods:extent unit="page">
|
||
|
|
<mods:start>39</mods:start>
|
||
|
|
<mods:end>63</mods:end>
|
||
|
|
</mods:extent>
|
||
|
|
</mods:part>
|
||
|
|
</mods:relatedItem>
|
||
|
|
<mods:location>
|
||
|
|
<mods:url>http://dx.doi.org/10.3897/zookeys.421.6342</mods:url>
|
||
|
|
</mods:location>
|
||
|
|
<mods:classification>journal article</mods:classification>
|
||
|
|
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.421.6342</mods:identifier>
|
||
|
|
<mods:identifier type="Pensoft-Pub">1313-2970-421-39</mods:identifier>
|
||
|
|
<mods:identifier type="ZBK">748B04579F8443E5A165C2CE1A36CE58</mods:identifier>
|
||
|
|
<mods:identifier type="ZooBank">748B04579F8443E5A165C2CE1A36CE58</mods:identifier>
|
||
|
|
</mods:mods>
|
||
|
|
<treatment ID-GBIF-Taxon="152053897" LSID="urn:lsid:plazi:treatment:C315E16D7E9C1FCCB655B913238C1DBC" httpUri="http://treatment.plazi.org/id/C315E16D7E9C1FCCB655B913238C1DBC" lastPageId="20" lastPageNumber="59" pageId="15" pageNumber="54">
|
||
|
|
<subSubSection pageId="15" pageNumber="54" type="multiple">
|
||
|
|
<paragraph pageId="15" pageNumber="54">
|
||
|
|
<pageBreakToken pageId="15" pageNumber="54" start="start">Taxon</pageBreakToken>
|
||
|
|
classification Animalia Lepidoptera Notodontidae
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection pageId="15" pageNumber="54" type="nomenclature">
|
||
|
|
<paragraph pageId="15" pageNumber="54">
|
||
|
|
<taxonomicName authority="Schaus, 1892" authorityName="Schaus" authorityYear="1892" class="Insecta" family="Notodontidae" genus="Elymiotis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Elymiotis tlotzin" order="Lepidoptera" pageId="15" pageNumber="54" phylum="Arthropoda" rank="species" species="tlotzin">Elymiotis tlotzin (Schaus, 1892)</taxonomicName>
|
||
|
|
<taxonomicNameLabel pageId="15" pageNumber="54">comb. n.</taxonomicNameLabel>
|
||
|
|
Figs 37-45
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection pageId="15" pageNumber="54" type="material examined">
|
||
|
|
<paragraph pageId="15" pageNumber="54">Material examined.</paragraph>
|
||
|
|
<paragraph pageId="15" pageNumber="54">11 males 12 females.</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection lastPageId="16" lastPageNumber="55" pageId="15" pageNumber="54" type="wild-caught adults">
|
||
|
|
<paragraph pageId="15" pageNumber="54">Wild-caught adults:</paragraph>
|
||
|
|
<paragraph lastPageId="16" lastPageNumber="55" pageId="15" pageNumber="54">
|
||
|
|
2 Males: INBIOCRI000584965 Costa Rica, Prov. Guanacaste, Bagaces, Ref. Nac. Fauna Silv. R. L. Rodriguez, Estacion Palo Verde, 10.349119-85.352345, 10 m, May 1991, U. Chavarria (INBio). Male: INB0003072431 Costa Rica, Prov. Guanacaste, Bagaces, Pque. Nal. Palo Verde, Sector Palo Verde, 10.366668-85.383266, 0-50 m, 3 May 2000, H. Mendez (INBio). Male: INBIOCRI000386810 Costa Rica, Prov. Guanacaste, Liberia, P. N. Sta. Rosa, Playa Naranjo, 10.80275-85.666572, 0-10 m, May 1991, E. Alcazar (INBio). Male: INBIOCRI002426620 Costa Rica, Prov. Guanacaste, Liberia, Sector Las Pailas, 4.5 Km. SW del Volcan Rincon de la Vieja, 10.776784-85.351913, 800 m, 24 June 1995, K. Taylor (INBio). Male: INB0004065577 Costa Rica, Prov. Guanacaste, Liberia, Santa Rosa Nat. Pk., 10.83641-85.615491, 300 m, 4-6 December 1979, D. H. Janzen (INBio). Male:
|
||
|
|
<pageBreakToken pageId="16" pageNumber="55" start="start">INB</pageBreakToken>
|
||
|
|
0003319696 Costa Rica, Prov. Guanacaste, Nicoya, P.N. Barra Honda, Sector Barra Honda, 10.169826-85.379137, 50 m, 25-30 December 2000, H. Mendez (INBio). Female: INBIOCRI001184551 Costa Rica, Prov. Guanacaste, Bagaces, P. N. Palo Verde, Estacion Palo Verde, 10.349119-85.352345, 10 m, 20 June 1993, U. Chavarria (INBio). Female: INB0003300310 Costa Rica, Prov. Guanacaste, Hojancha, Z.P. Nosara, Hojancha, R.F. Monte Alto, 10.011248-85.402778, 400 a 500 m, 27 July - 3 August 2000, H. Mendez (INBio). Female: INBIOCRI000674401 Costa Rica, Prov. Guanacaste, Liberia, P.N.Sta. Rosa, Playa Naranjo, 10.802713 - 85.67479, 0-10 m, March 1991, E. Alcazar (INBio). Female: INB0003956448 Costa Rica, Prov. Guanacaste, Nicoya, San Antonio, Humedal Mata Redonda, 10.328094-85.42111, 8 m, 6 July 2005, B. Gamboa, J. Azofeifa, J. Gutierrez, M. Moraga, Y. Cardenas (INBio).
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection lastPageId="17" lastPageNumber="56" pageId="16" pageNumber="55" type="reared from wild-caught caterpillars feeding on foliage of zizyphus guatemalensis (rhamnaceae)">
|
||
|
|
<paragraph pageId="16" pageNumber="55">
|
||
|
|
Reared from wild-caught caterpillars feeding on foliage of
|
||
|
|
<taxonomicName class="Magnoliopsida" family="Rhamnaceae" genus="Zizyphus" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Zizyphus guatemalensis" order="Rosales" pageId="16" pageNumber="55" phylum="Tracheophyta" rank="species" species="guatemalensis">Zizyphus guatemalensis</taxonomicName>
|
||
|
|
(
|
||
|
|
<taxonomicName genus="Rhamnaceae" lsidName="Rhamnaceae" pageId="16" pageNumber="55" rank="genus">Rhamnaceae</taxonomicName>
|
||
|
|
):
|
||
|
|
</paragraph>
|
||
|
|
<paragraph pageId="16" pageNumber="55">Male: 94-SRNP-2964 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Estero Naranjo, 10.80426-85.68285, 2 m, 9 June 1994, Gusaneros. Male: 98-SRNP-9137 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa, 10.83764-85.61871, 295 m, 14 August 1998, Manuel Pereira. Male: 01-SRNP-17295 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Carbonal, 10.77594-85.65799, 7 m, 2 November 2001, Gusaneros. Male: 06-SRNP-13290 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Estero Naranjo, 10.80426-85.68285, 2 m, 31 May 2006, Eilyn Camacho.</paragraph>
|
||
|
|
<paragraph lastPageId="17" lastPageNumber="56" pageId="16" pageNumber="55">
|
||
|
|
Female: 92-SRNP-736 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Vado Nisperal, 10.80212-85.65372, 10 m, 20 May 1992, Gusaneros. Female: 96-SRNP-1331 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Palo Seco, 10.79342-85.6666, 5 m, 31 May 1996, Gusaneros. Female: 96-SRNP-1332 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Palo Seco, 10.79342-85.6666, 5 m, 2 June 1996, Gusaneros. Female: 98-SRNP-9134 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa (adult at light), 10.83764-85.61871, 295 m, 2 August 1998, Guillermo Pereira. Female: 98-SRNP-9137 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa (adult at light), 10.83764-85.61871, 295 m, 14 August 1998, Guillermo Pereira. Female: 01-SRNP-17336 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Carbonal, 10.77594-85.65799, 7 m, 28 October 2001, Gusaneros. Female: 01-SRNP-17336 Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero Carbonal, 10.77594-85.65799, 7 m, 28 October 2001, Gusaneros. Female: 07-SRNP-112736 (COI barcoded), Costa Rica, Area Conservacion Guanacaste, Prov. Guanacaste, Sector Santa Rosa, Sendero los Patos (adult at light), 10.82097-85.63323, 251 m, 8 December 2007, H. Cambronero & S. Rios. Female: 11-SRNP-12732 (COI Barcoded), Costa Rica, Area Conservacion
|
||
|
|
<pageBreakToken pageId="17" pageNumber="56" start="start">Guanacaste</pageBreakToken>
|
||
|
|
, Prov. Guanacaste, Sector Santa Rosa, Area Administrativa (adult at light), 10.83764-85.61871, 295 m, 1 June 2011, Daniel H. Janzen
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection lastPageId="19" lastPageNumber="58" pageId="18" pageNumber="57" type="diagnosis">
|
||
|
|
<paragraph pageId="18" pageNumber="57">
|
||
|
|
<pageBreakToken pageId="18" pageNumber="57" start="start">Diagnosis</pageBreakToken>
|
||
|
|
.
|
||
|
|
</paragraph>
|
||
|
|
<paragraph pageId="18" pageNumber="57">Adults - (Figs 37-40) Medium-sized notodontid moths, FW = 15.42-19.28 mm, females larger than males; male antenna narrowly bipectinate, gradually narrowing to apex, which is simple; antennae of female simple; labial palpus porrect, composed by three segments; haustellum is well developed, ocelli absent; eyes smooth, round. Thorax mostly gray, tegula gray, all scales of the thorax are long and forked; patagium and prothorax with beige and light brown scales. FW costa straight, outer margin almost straight; accessory cell present. Male genitalia - (Figs 41-43) valvae elongated, sclerotized and mildly setose; sacculus pleats highly developed; uncus thin and long, with apex acute and setose, each socius wide at the base with two thin projections, acute and setose; saccus acute (Figs 41); phallus robust, wide at the base with two single subterminal lateral bumps, vesica long but shorter than phallus, wide at the base, long and thin distally, caltrop cornuti (Fig. 42); T8 rectangular shorter than St8, lateral margins straight, anterior margin simple and membranous, posterior margin slightly concave; St8 wide at anterior margin, posterior margin with a single median depression and two sclerotized small projections (Fig. 43). Female genitalia (Figs 44, 45) - The papillae anales small, roughly ovoid with elongated dorsal setae; lateral procecess of postvaginal plate with apices acute and sclerotized; posterior apophyses short and thin; lamella postvaginalis rectangular, sclerotized; ostium sclerotized, wide, funnel shape; DB short; CB wide and long, ovoid with surface membranous slightly rough; signum brick shape with a rough surface.</paragraph>
|
||
|
|
<caption pageId="18" pageNumber="57">
|
||
|
|
<paragraph pageId="18" pageNumber="57">
|
||
|
|
Figures 37-45.
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Elymiotis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Elymiotis tlotzin" order="Lepidoptera" pageId="18" pageNumber="57" phylum="Arthropoda" rank="species" species="tlotzin">Elymiotis tlotzin</taxonomicName>
|
||
|
|
37, 38 Male dorsal and ventral INBIOCRI002426620 39, 40 Female dorsal and ventral 96-SRNP-1332 41 Male genitalia INBIOCRI002426620 42 Phallus 43 Male St8 44, 45 Female genitalia INBIOCRI006744401.
|
||
|
|
</paragraph>
|
||
|
|
</caption>
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
<bibRefCitation author="Thiaucourt, P" journalOrPublisher="Lambillionea" pageId="21" pageNumber="60" pagination="531 - 538" title="Symmerista Huebner [1821] Description D'Especes Nouvelles Mesoamericaines (Lepidoptera: Notodontidae)." volume="107" year="2007">
|
||
|
|
<pageBreakToken pageId="19" pageNumber="58" start="start">Thiaucourt</pageBreakToken>
|
||
|
|
(2007)
|
||
|
|
</bibRefCitation>
|
||
|
|
"The species was described in the genus
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Edema" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Edema" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="genus">Edema</taxonomicName>
|
||
|
|
, cited by DRUCE (1898) in this genus, the species should be now in another genus." KIRBY (1892) lists
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Edema" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Edema" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="genus">Edema</taxonomicName>
|
||
|
|
(Walker, 1855) as a junior synonym of
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="genus">Symmerista</taxonomicName>
|
||
|
|
Hubner, [1821].
|
||
|
|
</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
The adult lacks the apical white stripe, the male genitalia framework places the genus in the
|
||
|
|
<taxonomicName lsidName="" pageId="19" pageNumber="58" rank="tribe" tribe="Nystaleini">Nystaleini</taxonomicName>
|
||
|
|
, but it differs from that of
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="genus">Symmerista</taxonomicName>
|
||
|
|
(Plate II, Fig. 10). Male genitalia: uncus with acute and long apex; socci in brackets; valve costa without apical membranous area, pleats highly developed; exopenis with two single subterminal lateral bumps; beam cornuti extensions, obsolete; distal edge St 8 with a single median depression, two sclerotized thickenings near the distal edge of T8.
|
||
|
|
</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
We propose that
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista tlotzin" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="species" species="tlotzin">Symmerista tlotzin</taxonomicName>
|
||
|
|
should be allocated to the genus
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Elymiotis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Elymiotis" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="genus">Elymiotis</taxonomicName>
|
||
|
|
Walker, 1857 for the following characteristics of the male genitalia: valvae elongated, sclerotized and setose; sacculus pleats highly developed; uncus thin and long, with apex acute and setose; socius wide at the base with two thin projections, acute and setose and caltrop cornuti.
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection pageId="19" pageNumber="58" type="natural history">
|
||
|
|
<paragraph pageId="19" pageNumber="58">Natural history</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">(Figs 46, 47, 48). 33 rearing records from Sector Santa Rosa, ACG.</paragraph>
|
||
|
|
<caption pageId="19" pageNumber="58">
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
Figures 46-48. Ultimate instar of
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Elymiotis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Elymiotis tlotzin" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="species" species="tlotzin">Elymiotis tlotzin</taxonomicName>
|
||
|
|
90-SRNP-1223 on its food plant (
|
||
|
|
<taxonomicName genus="Rhamnaceae" lsidName="Rhamnaceae" pageId="19" pageNumber="58" rank="genus">Rhamnaceae</taxonomicName>
|
||
|
|
:
|
||
|
|
<taxonomicName class="Magnoliopsida" family="Rhamnaceae" genus="Zizyphus" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Zizyphus guatemalensis" order="Rosales" pageId="19" pageNumber="58" phylum="Tracheophyta" rank="species" species="guatemalensis">Zizyphus guatemalensis</taxonomicName>
|
||
|
|
).
|
||
|
|
</paragraph>
|
||
|
|
</caption>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection pageId="19" pageNumber="58" type="food plants">
|
||
|
|
<paragraph pageId="19" pageNumber="58">Food plants.</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
<taxonomicName genus="Rhamnaceae" lsidName="Rhamnaceae" pageId="19" pageNumber="58" rank="genus">Rhamnaceae</taxonomicName>
|
||
|
|
,
|
||
|
|
<taxonomicName class="Magnoliopsida" family="Rhamnaceae" genus="Zizyphus" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Zizyphus guatemalensis" order="Rosales" pageId="19" pageNumber="58" phylum="Tracheophyta" rank="species" species="guatemalensis">Zizyphus guatemalensis</taxonomicName>
|
||
|
|
Hemsl. (n=33).
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection pageId="19" pageNumber="58" type="parasitoids">
|
||
|
|
<paragraph pageId="19" pageNumber="58">Parasitoids.</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
<taxonomicName family="Eulophidae" lsidName="" pageId="19" pageNumber="58" rank="family">Eulophidae</taxonomicName>
|
||
|
|
:
|
||
|
|
<taxonomicName class="Insecta" family="Eulophidae" genus="Euplectrus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Euplectrus" order="Hymenoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="genus">Euplectrus</taxonomicName>
|
||
|
|
(n=1).
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection pageId="19" pageNumber="58" type="distribution and habitat">
|
||
|
|
<paragraph pageId="19" pageNumber="58">Distribution and habitat.</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
Adult
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Elymiotis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Elymiotis tlotzin" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="species" species="tlotzin">Elymiotis tlotzin</taxonomicName>
|
||
|
|
have been collected in the dry forest ecosystem of Peninsula de Nicoya, and in the dry forests of Sector Santa Rosa and Sector Pailas of ACG, at elevations of 0 to 800 m. (Fig. 49).
|
||
|
|
</paragraph>
|
||
|
|
<caption pageId="19" pageNumber="58">
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
Figure 49. Map of Costa Rican collection sites for the four species of
|
||
|
|
<taxonomicName family="Notodontidae" lsidName="" pageId="19" pageNumber="58" rank="family">Notodontidae</taxonomicName>
|
||
|
|
discussed here.
|
||
|
|
</paragraph>
|
||
|
|
</caption>
|
||
|
|
</subSubSection>
|
||
|
|
<subSubSection lastPageId="20" lastPageNumber="59" pageId="19" pageNumber="58" type="remarks">
|
||
|
|
<paragraph pageId="19" pageNumber="58">Remarks.</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">DNA barcode female 11-SRNP-12732.</paragraph>
|
||
|
|
<paragraph pageId="19" pageNumber="58">
|
||
|
|
MHMYM2073-11 | 11-SRNP-12732 |
|
||
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Elymiotis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Elymiotis tlotzin" order="Lepidoptera" pageId="19" pageNumber="58" phylum="Arthropoda" rank="species" species="tlotzin">Elymiotis tlotzin</taxonomicName>
|
||
|
|
| COI-5P:
|
||
|
|
</paragraph>
|
||
|
|
<paragraph pageId="20" pageNumber="59">
|
||
|
|
<pageBreakToken pageId="20" pageNumber="59" start="start">AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTACTTCCACCCTCACTAACTTTATTGATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCCCTTTCATCTAA</pageBreakToken>
|
||
|
|
0TATTGCACATAGAGGAAGATCTGTAGATTTAGCAATTTTTTCACTTCATTTAGCTGGTATTTCATCGATTTTAGGAGCTATTAATTTTATTACAACGATTATTAATATACGACTTAATAACATAACTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCCGGAGCGATTACTATATTATTAACAGACCGTAATTTAAATACTTCATTTTTCGACCCTGCTGGTGGAGGAGATCCAATTCTTTATCAACATTTATTT
|
||
|
|
</paragraph>
|
||
|
|
</subSubSection>
|
||
|
|
</treatment>
|
||
|
|
</document>
|